View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_1D_low_43 (Length: 201)
Name: NF5139_1D_low_43
Description: NF5139_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_1D_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 2 - 188
Target Start/End: Original strand, 11619422 - 11619608
Alignment:
| Q |
2 |
tagataatactatattttttaataaggaatcaaactcggtacttcaaaatttacaacattcacacactcgatgtgtcaacaacttgagctagactcaagt |
101 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11619422 |
tagattataatatattttttaataaggaatcaaactcgatacttcaaaatttacaacattcacacactcgatgtgtcaacaacttgagctagactcaagt |
11619521 |
T |
|
| Q |
102 |
ggtaaaacgaattgcagttacatattagaaagtttgttattgaaag-nnnnnnnaatataaaatcaccaccattcatgttttgtcttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
11619522 |
ggtaaaacgaattgcagttacatattagaaagtttgttattgaaagttttttttaatat-aaatcaccaccattcatgtttagtcttt |
11619608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University