View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_2D_high_15 (Length: 240)
Name: NF5139_2D_high_15
Description: NF5139_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_2D_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 225
Target Start/End: Original strand, 42412516 - 42412724
Alignment:
| Q |
17 |
aatggaagatttcccgtaagaaagttgtgatccaaatacaatcttctccatgttgttcttagttttaatccatactcttttggaataggaccatgtaatt |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42412516 |
aatggaagatttcctgtaagaaagttgtgatccaaatacaatcttctccatgttgttcttagttttaatccatactcttttggaataggaccatgtaatt |
42412615 |
T |
 |
| Q |
117 |
gattgtttgataaatttattatagtcaagtttgtgaaagtcaccaaattcactggcaaatgacccttcaaattgttagcttgagcctcaagcaaacgaag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42412616 |
gattgtttgataaatttattatagtcaagtttgtgaaagtcaccaaattcactggcaaatgacccttcaaattgttagcttgagcctcaagcaaacgaag |
42412715 |
T |
 |
| Q |
217 |
tcgatgtcc |
225 |
Q |
| |
|
||| ||||| |
|
|
| T |
42412716 |
tcgttgtcc |
42412724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University