View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_2D_high_19 (Length: 224)
Name: NF5139_2D_high_19
Description: NF5139_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_2D_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 52 - 216
Target Start/End: Complemental strand, 20336462 - 20336298
Alignment:
| Q |
52 |
attttagtctttttacttttgaggg-ttttggtttggtcctccttctccctcctgtatttatttcctatttattgaannnnnnnnnnnngagattggcgg |
150 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||| |||||||| ||||| ||||| ||||||||| | ||||| |||| |
|
|
| T |
20336462 |
attttagtctttttactttagaggggttttggtttggtcctccctctccctcttgtatgtattttctatttatt-atatatttttttttgagataagcgg |
20336364 |
T |
 |
| Q |
151 |
cgtaggataagcaatctcaatggggtgtcaatccaattgaaatgtcgatgttttctcttgatgtcc |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
20336363 |
cgtaggataagcaatctcaacggggtgtcaatttaattggaatgtcgatgttttctcttgatgtcc |
20336298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 20334124 - 20334182
Alignment:
| Q |
1 |
tcaaatgggcattgatcaaggtttgatcatataagtctacgaaccaaaactattttagt |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
20334124 |
tcaaatgggcattgatcaaggtttgatcatataagtctacaaaccaaaactattatagt |
20334182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University