View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5139_2D_high_8 (Length: 359)

Name: NF5139_2D_high_8
Description: NF5139_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5139_2D_high_8
NF5139_2D_high_8
[»] chr8 (1 HSPs)
chr8 (222-346)||(8486665-8486789)


Alignment Details
Target: chr8 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 346
Target Start/End: Original strand, 8486665 - 8486789
Alignment:
222 aacattacttctttccttatatttttaggtctacgagttggagaaatggaacgtgattgcttaattgcatacggtgctagtatgttgatttttgagtgac 321  Q
    ||||| |||| ||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||    
8486665 aacatcacttgtttccttttatgtttaggtctacgagtcggagaaatggaacgtgattgcttaattgcatatggtgctagtatgttgatttttgagcgac 8486764  T
322 tcatgttatcccgtgattcttatga 346  Q
    ||||||||||  ||||| |||||||    
8486765 tcatgttatctagtgatccttatga 8486789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University