View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_2D_low_18 (Length: 359)
Name: NF5139_2D_low_18
Description: NF5139_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_2D_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 346
Target Start/End: Original strand, 8486665 - 8486789
Alignment:
| Q |
222 |
aacattacttctttccttatatttttaggtctacgagttggagaaatggaacgtgattgcttaattgcatacggtgctagtatgttgatttttgagtgac |
321 |
Q |
| |
|
||||| |||| ||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
8486665 |
aacatcacttgtttccttttatgtttaggtctacgagtcggagaaatggaacgtgattgcttaattgcatatggtgctagtatgttgatttttgagcgac |
8486764 |
T |
|
| Q |
322 |
tcatgttatcccgtgattcttatga |
346 |
Q |
| |
|
|||||||||| ||||| ||||||| |
|
|
| T |
8486765 |
tcatgttatctagtgatccttatga |
8486789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University