View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_2D_low_29 (Length: 249)
Name: NF5139_2D_low_29
Description: NF5139_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_2D_low_29 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 10 - 249
Target Start/End: Original strand, 27491912 - 27492150
Alignment:
| Q |
10 |
acatcatgagttctgaacattttcaattatgcagcttctgctatttgcttgcaacactatctactgtttcacatagccgatttttggcatttcgctactt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27491912 |
acatcatgagttctgaacattttcaattatgcagcttctgctatttgcttgcaacactatctactgtttcacatagccgatttttggcatttcgctactt |
27492011 |
T |
 |
| Q |
110 |
tctctttatctactagtactactgataacactgatttgaccaagtttcatgtgatcatattatttccaaaataattggtgggatatgattgaataggtgt |
209 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27492012 |
tc-ctttatctactagtactactgataacactgatttgaccaagtttcatgtaatcatattatttccaaaataattggtgggatatgattgaataggtgt |
27492110 |
T |
 |
| Q |
210 |
ctaaaacgtttttacactgtcagcgaatggcatttaaatt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27492111 |
ctaaaacgtttttacactgtcagcgaatggcatttaaatt |
27492150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 93
Target Start/End: Original strand, 17243213 - 17243258
Alignment:
| Q |
48 |
tgctatttgcttgcaacactatctactgtttcacatagccgatttt |
93 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||||||| |||||| |
|
|
| T |
17243213 |
tgctatttgcctgcaacactatcttctatttcacatagcagatttt |
17243258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 100
Target Start/End: Original strand, 7278354 - 7278394
Alignment:
| Q |
60 |
gcaacactatctactgtttcacatagccgatttttggcatt |
100 |
Q |
| |
|
|||||||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
7278354 |
gcaacactatctgctatttcacatagcagatttttggcatt |
7278394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University