View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_2D_low_32 (Length: 243)
Name: NF5139_2D_low_32
Description: NF5139_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_2D_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 33200238 - 33200031
Alignment:
| Q |
18 |
aataaagtatctttatgccaatttgctattcgaaacgtaacacgatgtgtatatacttttttatgcatgtagcatatggatcacacttgtcatcattact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33200238 |
aataaagtatctttatgccaatttgctattcgaaacgtaacacgatgtgtatatacttttttatgcatgtagcatatggatcacacttgtcatcattact |
33200139 |
T |
 |
| Q |
118 |
taattataatgcgtttgataatcaactttacagaatcatcttaatttgtttatgcagnnnnnnnnagattgtaatcatatattataacgttaaggaaaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
33200138 |
taattataatgcgtttgataatcaactttacagaatcatcttaatttgtttatgcagttttttttggattgtaatcatatagtataacgttaaggaaaaa |
33200039 |
T |
 |
| Q |
218 |
gacgtatg |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
33200038 |
gacgtatg |
33200031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University