View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_2D_low_42 (Length: 227)
Name: NF5139_2D_low_42
Description: NF5139_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_2D_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 6093473 - 6093267
Alignment:
| Q |
18 |
aatttgagcaaaatgcaatacctcgacctccgatgtcctggtgttgtgattaccgtcgaagatgttcaagggatgaataagttggaatattttggaggtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6093473 |
aatttgagcaaaatgcaatacctcgacctccgatgtcctggtgttgtgattactgttgaagatgttcaagggatgaataagttggaatattttggaggtg |
6093374 |
T |
 |
| Q |
118 |
cattacttgtcgattactactcccaaaaagtactcgacataagttttatgctnnnnnnntatcatctcattttagggaaaatgtatgatgaagaaggtga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
6093373 |
cattacttgtcgattactactcccaaaaagtactcgacataagttttatgctaaaaaaatatcatctcattttaggaaaaatgtatgatgaagaaggtaa |
6093274 |
T |
 |
| Q |
218 |
ttggtgg |
224 |
Q |
| |
|
||||||| |
|
|
| T |
6093273 |
ttggtgg |
6093267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University