View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_2D_low_45 (Length: 223)
Name: NF5139_2D_low_45
Description: NF5139_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_2D_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 54267752 - 54267956
Alignment:
| Q |
1 |
tctaaatacagaggtgtagcaaggtatatattagctagttcttcttatacatcaaatttctttgatcaacttttgtttatatttaagaatggacaagagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| | |||||||| |
|
|
| T |
54267752 |
tctaaatacagaggtgtagcaaggtatatattagctagttcttcttatacatcaaatttctttgatcaatttttgcttatatttaagaccgaacaagagt |
54267851 |
T |
 |
| Q |
101 |
gtaatgaggaataannnnnnnnactcaattaagaatcaatttaaggtttaatgaatttgcttttccattaatgttctagacatcatcataacggaaggtg |
200 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54267852 |
gtaatgaagaataattttttttactcaattaagaatcaatttaaggtttaatgaatttgcttttccattaatgttctagacatcatcataacggaaggtg |
54267951 |
T |
 |
| Q |
201 |
ggagg |
205 |
Q |
| |
|
||||| |
|
|
| T |
54267952 |
ggagg |
54267956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University