View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_2D_low_50 (Length: 208)
Name: NF5139_2D_low_50
Description: NF5139_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_2D_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 22 - 189
Target Start/End: Complemental strand, 17490420 - 17490253
Alignment:
| Q |
22 |
caagttacaatatttcaaagtgatttatccaaatatctcagtgtacatttaacttgagttagatgcattaggcttgggcaactgtttgcgtgctcaaaat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17490420 |
caagttacaatatttcaaagtgatttatccaaatatctcagtgtacatttaacttgagttagatgcattaggcttgggcaactgtttgcttgctcaaaat |
17490321 |
T |
 |
| Q |
122 |
ttgtatttaatttgactgtaagtgtacatttgaccggctattgtcagttactaggtccataatttagc |
189 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17490320 |
ttgtatttaatttgattgtaagtgtacatttgaccggctattgtcagttactatgtccataatttagc |
17490253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University