View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_high_10 (Length: 233)
Name: NF5139_high_10
Description: NF5139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 5997049 - 5996838
Alignment:
| Q |
12 |
atgacctgtaatcctacagtacaaattaactagctaataaagttgtaaaaatattacagatcagtgtttacccacgagaagaaccggttccgaaccccga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
5997049 |
atgacctgtaatcctacagtacaaattaactagctaataaagttgtaaaaatattacagatcagtgtttacccacaagaagaacgggttccgaaccccga |
5996950 |
T |
 |
| Q |
112 |
tagctatagattaaggaagataaagtacttcaagatgaggcgtgaacgcaaaaaggctgctaaagaaagaagagcttttcaaccacagctaatgctcgct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5996949 |
tagctatagattaaggaagataaagtacttcaagatgaggcgtgaacgcaaaaaggctgctaaagaaagaagagcttttcaaccacagctaatgctcgct |
5996850 |
T |
 |
| Q |
212 |
tccgttgatgat |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5996849 |
tccgttgatgat |
5996838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University