View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_high_4 (Length: 350)
Name: NF5139_high_4
Description: NF5139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 120 - 332
Target Start/End: Original strand, 28892649 - 28892861
Alignment:
| Q |
120 |
gtagtaccttgcaatttcaagaccaatgccactagtagaaccagtaacaatacaagtgagatcattgattggtggtaatggcatagggttatgtaaatga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
28892649 |
gtagtaccttgcaatttcaagaccaatgccactagtagaaccagtaacaatacaagtgagatcattgattggtggtaacggcataggattatgcaaatga |
28892748 |
T |
|
| Q |
220 |
cttgcgaggattcgttggaatagaaattcttagaataaattgaaccatcctcttaaccattctatccaacccaaacattgcttctttttcttcttcaaca |
319 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28892749 |
cttgccgtgattcgttggaatagaaattcgtagaataaattgaaccatcctcttaaccattctatccaacccaaactttgcttctttttcttcttcaaca |
28892848 |
T |
|
| Q |
320 |
atggtttgttgct |
332 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
28892849 |
atggttcgttgct |
28892861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University