View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5139_low_5 (Length: 286)
Name: NF5139_low_5
Description: NF5139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5139_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 19 - 179
Target Start/End: Complemental strand, 43527897 - 43527735
Alignment:
| Q |
19 |
cattgttgatggcagtaacag--gaagaagttacccaccattaagagtgaggaagtgcgacgaaagaaacctgataataacatatggacaaattattcgt |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43527897 |
cattgttgatggcagtaacagaggaagaagttacccaccgttaagagtgaggaagtgggacgaaagaaacttgataataacatatggacaaattattcgt |
43527798 |
T |
|
| Q |
117 |
tggcatttctccacttgaatatgttaatgacgtttacggtgagaaggaaatgcaaatgtgaat |
179 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43527797 |
tgccatttctccacttgaatatgttaatgacgtttacggtgagaaggaaatgcaaatgtgaat |
43527735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 191 - 275
Target Start/End: Complemental strand, 43527670 - 43527586
Alignment:
| Q |
191 |
gagtgtttaggtcaaaactagagtactagattaatctaaatggacctagtagtttcaataaatagttgggcacatagagtagtat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43527670 |
gagtgtttaggtcaaaactagagtactagattaatctaaatggacctagtagtttcaataaatagttgggcacatagagtagtat |
43527586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University