View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5140-Insertion-2 (Length: 268)
Name: NF5140-Insertion-2
Description: NF5140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5140-Insertion-2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 266
Target Start/End: Original strand, 52511761 - 52512020
Alignment:
| Q |
7 |
agtacctatgtgttacctttaataaatcagtcatttgtttgtcaattttgaacttgctcatagaagttttaatctttctctcttttctcatggaaatatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52511761 |
agtacctatgtgttacctttaataaatcagtcatttatttgtcaattttgaacttgctcataaaagttttaatctttctctcttttctcatggaaatatt |
52511860 |
T |
 |
| Q |
107 |
ggcattactagagttcgcgatgagatgtgaactctgtctcttaaaattacaaagccaaactcttacggttgagctgacattcgtatcttattagtttcta |
206 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52511861 |
ggcattactagagttcgcgatgagatttgaactctgtctcttaaaattacaaagtcaaactcttacagttgagctgacattcgtatcttattagtttcta |
52511960 |
T |
 |
| Q |
207 |
ccagtatttgattcactgataacttctttcagggcttattatattcccatctccaacaaa |
266 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52511961 |
tcagtatttgattcactgacaacttctttcagggcttattatattcccatctccagcaaa |
52512020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University