View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5141-Insertion-5 (Length: 381)
Name: NF5141-Insertion-5
Description: NF5141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5141-Insertion-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 114 - 259
Target Start/End: Complemental strand, 3144694 - 3144550
Alignment:
| Q |
114 |
taacctgacaaacttgccatcagattgaagtgcatcaggctttgaacccaacttcataaacttcannnnnnnnnnnnnnnnnncttgaaaaccaaacaaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3144694 |
taacctgacaaacttgccatcagattgaagtgcatcaggctttgaacccaacttcataaacttca-tttttgtttctttttttcttgaaaaccaaacaaa |
3144596 |
T |
|
| Q |
214 |
gaaagtagggtcacgtatgttgagaagtaagacagtgaaagaaagc |
259 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3144595 |
gaaagtaggatcacgtatgttgagaagtaagacagtgaaagaaagc |
3144550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 309 - 381
Target Start/End: Complemental strand, 3144501 - 3144429
Alignment:
| Q |
309 |
cgtgttaaggtaatgaaggaaatgaatgcagttaataatgttagttggtgaatgaagtcagaaataatagaga |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3144501 |
cgtgttaaggtaatgaaggaaatgaatgcagttaataatgtaagttggtgaatgaagtcagaaataatagaga |
3144429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University