View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5141-Insertion-6 (Length: 297)

Name: NF5141-Insertion-6
Description: NF5141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5141-Insertion-6
NF5141-Insertion-6
[»] chr2 (1 HSPs)
chr2 (8-253)||(43102634-43102875)


Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 253
Target Start/End: Original strand, 43102634 - 43102875
Alignment:
8 attatataaaggactatatatggggtcttgaggaaataaatatatcaacttgggaggtagggcggtcctcctaaatttggttatcatccatacatatctt 107  Q
    |||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43102634 attatataaaggactat----ggggtcttgaggaaataaatatatcaacttgggaggtagggcggtcctcctaaatttggttatcatccatacatatctt 43102729  T
108 ccacttggttgtgtgccactgaggataggttgactatcaaagactatttaaggtttcatagcagcaaaatggtaggg---tatgggagattggacagtac 204  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||   ||    
43102730 ccacttggttgtgtgccactgaggataggttggctatcaaagactatttaaggtttcatagcagcaaaatggtagggtattatgggagattggac---ac 43102826  T
205 tgggaggaagatgagtgtgtatgggagctctcgtggatgcaaacgttgt 253  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
43102827 tgggaggaagatgagtgtgtatgggagctctcgtggatgcaaacgttgt 43102875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University