View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5141-Insertion-6 (Length: 297)
Name: NF5141-Insertion-6
Description: NF5141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5141-Insertion-6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 253
Target Start/End: Original strand, 43102634 - 43102875
Alignment:
| Q |
8 |
attatataaaggactatatatggggtcttgaggaaataaatatatcaacttgggaggtagggcggtcctcctaaatttggttatcatccatacatatctt |
107 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102634 |
attatataaaggactat----ggggtcttgaggaaataaatatatcaacttgggaggtagggcggtcctcctaaatttggttatcatccatacatatctt |
43102729 |
T |
 |
| Q |
108 |
ccacttggttgtgtgccactgaggataggttgactatcaaagactatttaaggtttcatagcagcaaaatggtaggg---tatgggagattggacagtac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
43102730 |
ccacttggttgtgtgccactgaggataggttggctatcaaagactatttaaggtttcatagcagcaaaatggtagggtattatgggagattggac---ac |
43102826 |
T |
 |
| Q |
205 |
tgggaggaagatgagtgtgtatgggagctctcgtggatgcaaacgttgt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102827 |
tgggaggaagatgagtgtgtatgggagctctcgtggatgcaaacgttgt |
43102875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University