View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5141-Insertion-8 (Length: 91)
Name: NF5141-Insertion-8
Description: NF5141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5141-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 1e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 7 - 91
Target Start/End: Original strand, 37807350 - 37807434
Alignment:
| Q |
7 |
aactctttcaccggaatcaccatgtttggcatggaagtcacatgatcaataaccgctaatctaactttattactactaccttcgc |
91 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37807350 |
aactctttcaccggaatcaccatgcttggcatggaagtcacatgatcaataaccgctaatctaactttattactactaccttcgc |
37807434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University