View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5141_high_14 (Length: 250)
Name: NF5141_high_14
Description: NF5141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5141_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 124 - 218
Target Start/End: Original strand, 4724143 - 4724237
Alignment:
| Q |
124 |
tcgtcaaagtcattttattttatcaggtgcatagacatatcaaataaggtgcagtataaaattagttcgcatgtacgtcaaacacaatgaagtat |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4724143 |
tcgtcaaagtcatattattttatcaggtgcatagacatatcaaataaggtgcagtacaaaattagttcgcatgtacgtcaaacacaatgaagtat |
4724237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 4724057 - 4724097
Alignment:
| Q |
1 |
ctcatacatctccctcttctctctcatatgtttccaatatg |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4724057 |
ctcatacatctccctcttctctctcatatgtttccaatatg |
4724097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University