View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5141_high_15 (Length: 238)
Name: NF5141_high_15
Description: NF5141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5141_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 222
Target Start/End: Complemental strand, 34853567 - 34853358
Alignment:
| Q |
13 |
gttttgcttaattacactttcgatttttatgttttatcatactcacaaaagtatccacctttttatagattgaactttcaggtcccactattattttatt |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34853567 |
gttttgcttaattacactttcggtttttctgttttatcatactcacaaaattatccacctttttatagattgaactttcaggtcccactattattttatt |
34853468 |
T |
 |
| Q |
113 |
tgctgcaaatttgtccaagtacaatatggctcggggaatgcaatcccgcccagaaataaatagcgcagatcatcaaatacaaagaataactcgtcattta |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34853467 |
tgctgcaaatttttccaagtacaatatggctcggggaatgccatcccgcccagaaataaatagcgcagatcatcaaatacaaagaataactcgtcattta |
34853368 |
T |
 |
| Q |
213 |
tgcgaatatt |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
34853367 |
tgcgaatatt |
34853358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 71 - 130
Target Start/End: Complemental strand, 34857940 - 34857881
Alignment:
| Q |
71 |
ctttttatagattgaactttcaggtcccactattattttatttgctgcaaatttgtccaa |
130 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||| || ||||||||| |||||||||||| |
|
|
| T |
34857940 |
ctttttatggattgaactttcaggtcccgctatttttgtatttgctggaaatttgtccaa |
34857881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University