View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5141_high_15 (Length: 238)

Name: NF5141_high_15
Description: NF5141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5141_high_15
NF5141_high_15
[»] chr5 (2 HSPs)
chr5 (13-222)||(34853358-34853567)
chr5 (71-130)||(34857881-34857940)


Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 222
Target Start/End: Complemental strand, 34853567 - 34853358
Alignment:
13 gttttgcttaattacactttcgatttttatgttttatcatactcacaaaagtatccacctttttatagattgaactttcaggtcccactattattttatt 112  Q
    |||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
34853567 gttttgcttaattacactttcggtttttctgttttatcatactcacaaaattatccacctttttatagattgaactttcaggtcccactattattttatt 34853468  T
113 tgctgcaaatttgtccaagtacaatatggctcggggaatgcaatcccgcccagaaataaatagcgcagatcatcaaatacaaagaataactcgtcattta 212  Q
    |||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34853467 tgctgcaaatttttccaagtacaatatggctcggggaatgccatcccgcccagaaataaatagcgcagatcatcaaatacaaagaataactcgtcattta 34853368  T
213 tgcgaatatt 222  Q
    ||||||||||    
34853367 tgcgaatatt 34853358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 71 - 130
Target Start/End: Complemental strand, 34857940 - 34857881
Alignment:
71 ctttttatagattgaactttcaggtcccactattattttatttgctgcaaatttgtccaa 130  Q
    |||||||| ||||||||||||||||||| ||||| || ||||||||| ||||||||||||    
34857940 ctttttatggattgaactttcaggtcccgctatttttgtatttgctggaaatttgtccaa 34857881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University