View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5141_high_16 (Length: 237)

Name: NF5141_high_16
Description: NF5141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5141_high_16
NF5141_high_16
[»] chr4 (1 HSPs)
chr4 (1-176)||(4723787-4723957)


Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 4723957 - 4723787
Alignment:
1 cgttatcaccgtttcacatatatgaactattgagatttgtttaaattggactattgatgtgaaccttgataataaatatatagtgtgaaatgtgcactat 100  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||    
4723957 cgttatcacggtttcacatatatgaactattgagatttgtttaaattggactattgatgtgaaccttgataataaata----gtgtgaaatgtgcactat 4723862  T
101 aaaatgtgactacctcttgagtaagaaccttgatataaaccaaaggtacatcatggggaaattactaagtggataa 176  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||    
4723861 aaaatgtgactaccccttgagtaagaaccttgatataaaccaaaggtacatca-gggggaattactaagtggataa 4723787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University