View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5141_low_11 (Length: 251)

Name: NF5141_low_11
Description: NF5141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5141_low_11
NF5141_low_11
[»] chr4 (1 HSPs)
chr4 (39-232)||(29797678-29797871)
[»] chr1 (1 HSPs)
chr1 (53-232)||(49600821-49600999)
[»] chr3 (1 HSPs)
chr3 (170-232)||(4490002-4490064)


Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 39 - 232
Target Start/End: Original strand, 29797678 - 29797871
Alignment:
39 cctacttaaaaacggtgacaacgttgatacgtatgtacgtctagcaaatggggaatggagagccacatgcgtcagcaaccttgatggcattgggagagct 138  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29797678 cctacttaaaaacggtgacaaggttgatacgtatgtacgtctagcaaatggggaatggagagccacatgcgtcagcaaccttgatggcattgggagagct 29797777  T
139 aacaagtttcttaaggttaggatctttcaaatattggcaaaggaaggcttttgttccttcagtttactgcaacaaattgcagagggagggttgg 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
29797778 aacaagtttcttaaggttaggatctttcaaatattggcaaaggaaggcttttgttccttcagtttactgcaacaaattgcagaaggagggttgg 29797871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 53 - 232
Target Start/End: Complemental strand, 49600999 - 49600821
Alignment:
53 gtgacaacgttgatacgtatgtacgtctagcaaatggggaatggagagccacatgcgtcagcaaccttgatggcattgggagagctaacaagtttcttaa 152  Q
    ||||||| |||||||| |||||  ||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||||| |||||| ||||||||    
49600999 gtgacaaggttgatacttatgt--gtctagcaaatcgggaatggagagccacatgcatcagaaaccttgatggcattgggagagttaacaaatttcttaa 49600902  T
153 ggttaggatctttcaaatattggcaaagg-aaggcttttgttccttcagtttactgcaacaaattgcagagggagggttgg 232  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||    
49600901 ggttaggatctttcaaatattggcaaaggcaaggcttttgttccttcagtttactgcaacaaattgcagaaggagggttgg 49600821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 170 - 232
Target Start/End: Complemental strand, 4490064 - 4490002
Alignment:
170 tattggcaaaggaaggcttttgttccttcagtttactgcaacaaattgcagagggagggttgg 232  Q
    |||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||    
4490064 tattggcaaaggaaggctttcgctccttcagtttactgcaacaaattgcagaaggagggttgg 4490002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University