View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5141_low_11 (Length: 251)
Name: NF5141_low_11
Description: NF5141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5141_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 39 - 232
Target Start/End: Original strand, 29797678 - 29797871
Alignment:
| Q |
39 |
cctacttaaaaacggtgacaacgttgatacgtatgtacgtctagcaaatggggaatggagagccacatgcgtcagcaaccttgatggcattgggagagct |
138 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29797678 |
cctacttaaaaacggtgacaaggttgatacgtatgtacgtctagcaaatggggaatggagagccacatgcgtcagcaaccttgatggcattgggagagct |
29797777 |
T |
 |
| Q |
139 |
aacaagtttcttaaggttaggatctttcaaatattggcaaaggaaggcttttgttccttcagtttactgcaacaaattgcagagggagggttgg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29797778 |
aacaagtttcttaaggttaggatctttcaaatattggcaaaggaaggcttttgttccttcagtttactgcaacaaattgcagaaggagggttgg |
29797871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 53 - 232
Target Start/End: Complemental strand, 49600999 - 49600821
Alignment:
| Q |
53 |
gtgacaacgttgatacgtatgtacgtctagcaaatggggaatggagagccacatgcgtcagcaaccttgatggcattgggagagctaacaagtttcttaa |
152 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
49600999 |
gtgacaaggttgatacttatgt--gtctagcaaatcgggaatggagagccacatgcatcagaaaccttgatggcattgggagagttaacaaatttcttaa |
49600902 |
T |
 |
| Q |
153 |
ggttaggatctttcaaatattggcaaagg-aaggcttttgttccttcagtttactgcaacaaattgcagagggagggttgg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49600901 |
ggttaggatctttcaaatattggcaaaggcaaggcttttgttccttcagtttactgcaacaaattgcagaaggagggttgg |
49600821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 170 - 232
Target Start/End: Complemental strand, 4490064 - 4490002
Alignment:
| Q |
170 |
tattggcaaaggaaggcttttgttccttcagtttactgcaacaaattgcagagggagggttgg |
232 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4490064 |
tattggcaaaggaaggctttcgctccttcagtttactgcaacaaattgcagaaggagggttgg |
4490002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University