View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5141_low_15 (Length: 250)

Name: NF5141_low_15
Description: NF5141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5141_low_15
NF5141_low_15
[»] chr4 (2 HSPs)
chr4 (124-218)||(4724143-4724237)
chr4 (1-41)||(4724057-4724097)


Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 124 - 218
Target Start/End: Original strand, 4724143 - 4724237
Alignment:
124 tcgtcaaagtcattttattttatcaggtgcatagacatatcaaataaggtgcagtataaaattagttcgcatgtacgtcaaacacaatgaagtat 218  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
4724143 tcgtcaaagtcatattattttatcaggtgcatagacatatcaaataaggtgcagtacaaaattagttcgcatgtacgtcaaacacaatgaagtat 4724237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 4724057 - 4724097
Alignment:
1 ctcatacatctccctcttctctctcatatgtttccaatatg 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
4724057 ctcatacatctccctcttctctctcatatgtttccaatatg 4724097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University