View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5141_low_17 (Length: 237)
Name: NF5141_low_17
Description: NF5141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5141_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 4723957 - 4723787
Alignment:
| Q |
1 |
cgttatcaccgtttcacatatatgaactattgagatttgtttaaattggactattgatgtgaaccttgataataaatatatagtgtgaaatgtgcactat |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4723957 |
cgttatcacggtttcacatatatgaactattgagatttgtttaaattggactattgatgtgaaccttgataataaata----gtgtgaaatgtgcactat |
4723862 |
T |
 |
| Q |
101 |
aaaatgtgactacctcttgagtaagaaccttgatataaaccaaaggtacatcatggggaaattactaagtggataa |
176 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
4723861 |
aaaatgtgactaccccttgagtaagaaccttgatataaaccaaaggtacatca-gggggaattactaagtggataa |
4723787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University