View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5142_high_11 (Length: 305)
Name: NF5142_high_11
Description: NF5142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5142_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 3 - 134
Target Start/End: Original strand, 47117006 - 47117137
Alignment:
| Q |
3 |
tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47117006 |
tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatca |
47117105 |
T |
|
| Q |
103 |
ccatcttcgccggtgatgatgtcgccagtgaa |
134 |
Q |
| |
|
|| ||||| |||||||||||||||||| |||| |
|
|
| T |
47117106 |
ccgtcttcaccggtgatgatgtcgccattgaa |
47117137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University