View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5143-Insertion-6 (Length: 253)
Name: NF5143-Insertion-6
Description: NF5143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5143-Insertion-6 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 2e-44; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 155 - 253
Target Start/End: Complemental strand, 4216694 - 4216596
Alignment:
| Q |
155 |
cttcaaaaataccctttgtttggattcttaaatacgaacgattttttggattttataatctaaaatgtgcctagattccaacaagcttcttgcaatggt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4216694 |
cttcaaaaataccctttgtttggattcttaaatacgaacgatttttcggattttataatctaaaatgtgcctagattccaacaaacttcttgcaatggt |
4216596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 1e-36
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 4216846 - 4216738
Alignment:
| Q |
8 |
atctctgccctttgttgggcttagnnnnnnngtttcattcttgctgaaggatccaaatattgcgagcaaattgaatcmaacatcgctccatttgatattg |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
4216846 |
atctctgccctttgttgggcttagtttttttgtttcattcttgctgaaggatccaaatattgtgagcaaattgaatcaaacatcgctgcatttgatattg |
4216747 |
T |
|
| Q |
108 |
gactattac |
116 |
Q |
| |
|
||||||||| |
|
|
| T |
4216746 |
gactattac |
4216738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 77; E-Value: 5e-36
Query Start/End: Original strand, 157 - 253
Target Start/End: Complemental strand, 3797567 - 3797471
Alignment:
| Q |
157 |
tcaaaaataccctttgtttggattcttaaatacgaacgattttttggattttataatctaaaatgtgcctagattccaacaagcttcttgcaatggt |
253 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
3797567 |
tcaaaaataccctttatttgaattcttaaatacgaacgatttttcggattttataatctaaaacgtgcctagattccaacaagctgcttgcaatggt |
3797471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 206
Target Start/End: Complemental strand, 20535190 - 20535144
Alignment:
| Q |
160 |
aaaataccctttgtttggattcttaaatacgaacgattttttggatt |
206 |
Q |
| |
|
||||||| ||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
20535190 |
aaaatacactttgtttggattattaaatcggaacgattttttggatt |
20535144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University