View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5143_high_32 (Length: 220)

Name: NF5143_high_32
Description: NF5143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5143_high_32
NF5143_high_32
[»] chr2 (1 HSPs)
chr2 (21-205)||(29635721-29635905)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 21 - 205
Target Start/End: Complemental strand, 29635905 - 29635721
Alignment:
21 aaatgattgagtgaactcacccactctttaggattcacttcacccttttgtacctttatgtgtagaatttgaattattgcccacaaagtgtttgtaaaat 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
29635905 aaatgattgagtgaactcacccactctttaggattcacttcacccttttttacctttatgtgtagaatttgaattattgcccacaaagtgtttgtaaaat 29635806  T
121 tgactgggagagaaataggcaaaagggcttttgagaataaggaaaataagagagttacgtggaagataggttggtgtattgtata 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||    
29635805 tgactgggagagaaataggcaaaagggcttttgagaataaggaaaataagagagttacgtggaagatagattggagtattgtata 29635721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University