View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5143_high_32 (Length: 220)
Name: NF5143_high_32
Description: NF5143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5143_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 21 - 205
Target Start/End: Complemental strand, 29635905 - 29635721
Alignment:
| Q |
21 |
aaatgattgagtgaactcacccactctttaggattcacttcacccttttgtacctttatgtgtagaatttgaattattgcccacaaagtgtttgtaaaat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29635905 |
aaatgattgagtgaactcacccactctttaggattcacttcacccttttttacctttatgtgtagaatttgaattattgcccacaaagtgtttgtaaaat |
29635806 |
T |
 |
| Q |
121 |
tgactgggagagaaataggcaaaagggcttttgagaataaggaaaataagagagttacgtggaagataggttggtgtattgtata |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
29635805 |
tgactgggagagaaataggcaaaagggcttttgagaataaggaaaataagagagttacgtggaagatagattggagtattgtata |
29635721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University