View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5143_low_19 (Length: 315)
Name: NF5143_low_19
Description: NF5143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5143_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 147 - 298
Target Start/End: Complemental strand, 33535077 - 33534927
Alignment:
| Q |
147 |
cttcattatcgaatgcatagaatgatgtaatagttcatacctaagctcctttcattctttaacttcaagtttcatgccaagaatctagtatatgaatatg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33535077 |
cttcattatcgaatgcatagaatgatgtaatagttcatacctaagctcctt-cattctttaacttcaagtttcatgccaagaatctagtatatgaatatg |
33534979 |
T |
|
| Q |
247 |
actatttcaaagtctctatgtactatatatcaacctaccaaacgtgtaccat |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33534978 |
actatttcaaagtctctatgtactatatatcaacctaccaaacgtgtaccat |
33534927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 33535219 - 33535164
Alignment:
| Q |
1 |
ttttcaatgctttatttttagtcaaaaagtattctcttccaaattacacgtaaacc |
56 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33535219 |
ttttcaatgctttatttttggtcaaaaagtattctcttctaaattacacgtaaacc |
33535164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University