View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5143_low_20 (Length: 298)
Name: NF5143_low_20
Description: NF5143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5143_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 101 - 288
Target Start/End: Complemental strand, 1588716 - 1588529
Alignment:
| Q |
101 |
tattcttacgtattatttacatatatgatcttcacattgacggtggaatttgaactcagatctttgttagaagtggttgagttagcttaannnnnnnngg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
1588716 |
tattcttacgtattatttacatatatgatcttcacattgacggtggaatttgaactcggatctttgttagaagtggttgagttagcttaattttttttgg |
1588617 |
T |
|
| Q |
201 |
ggatcgaatatatgtcttaattctaatctcgaatgaaatctttttatcagttggaaaaagtttcaaaattatttctctatactctctg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1588616 |
ggatcgaatatatgtcttaattctaatctcgaatgaaatctttttatcagttggaaaaagtttcaaaattatttctctatactctctg |
1588529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 18 - 94
Target Start/End: Complemental strand, 1590555 - 1590479
Alignment:
| Q |
18 |
ggaatcttttcaccagcgctgccttgctttataacatctccatgttaaataaaaagtctcaacctttaaggttattt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
1590555 |
ggaatcttttcaccagcgctgccttgctttataacatcttcacgttaaataaaaagtctcaacctttaaggttattt |
1590479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University