View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5144_low_7 (Length: 218)
Name: NF5144_low_7
Description: NF5144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5144_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 13 - 139
Target Start/End: Original strand, 45441434 - 45441560
Alignment:
| Q |
13 |
atcatcatcatgagaattggagagtagtcctttgagattttgagcaactgtgaagtgagacctcccactacggcgcttgtggtgggccacagccaatttc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45441434 |
atcatcatcatgagaattggagagtagtcctttgagattttgagcaactgtgaagtgagacctcccactacggcgcttgtggtgggcaacagccaatttc |
45441533 |
T |
|
| Q |
113 |
ctattctgtcgtccctgaccttcctac |
139 |
Q |
| |
|
|||||||||||||| |||||||||||| |
|
|
| T |
45441534 |
ctattctgtcgtccatgaccttcctac |
45441560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 195
Target Start/End: Original strand, 45441581 - 45441613
Alignment:
| Q |
163 |
catgtgagtcttacttaatagcaaagtgatatt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45441581 |
catgtgagtcttacttaatagcaaagtgatatt |
45441613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University