View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145-Insertion-10 (Length: 208)
Name: NF5145-Insertion-10
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145-Insertion-10 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 208
Target Start/End: Complemental strand, 3307420 - 3307220
Alignment:
| Q |
8 |
gtgataagagcatctacataccatgacctaactcatttttggtttcccaacttgtcaccaccactacccgcactctcataatcctcctccgaggtaatct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
3307420 |
gtgataagagcatctacataccatgacctaactcatttttggtttcccaacttgtcaccaccactacccacactctcataatcctcctccgaggcaatct |
3307321 |
T |
|
| Q |
108 |
catcttgaacggaatccttttttcccctttcttgtgacaattattcttgaagttattggtcttgtgacaattgaagcatttatactttgttttttcattc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3307320 |
catcttgaacggaatccttttttcccctttcttgtgacaattattcttgaagttattggtcttgtgacaattgaagcatttatactttgttttttcattc |
3307221 |
T |
|
| Q |
208 |
c |
208 |
Q |
| |
|
| |
|
|
| T |
3307220 |
c |
3307220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 152 - 194
Target Start/End: Complemental strand, 16549635 - 16549593
Alignment:
| Q |
152 |
tcttgaagttattggtcttgtgacaattgaagcatttatactt |
194 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
16549635 |
tcttgaagtgattggtcttgtgacaattgaagcatttgtactt |
16549593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University