View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145-Insertion-11 (Length: 145)
Name: NF5145-Insertion-11
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145-Insertion-11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 4e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 4e-36
Query Start/End: Original strand, 10 - 86
Target Start/End: Original strand, 4823999 - 4824075
Alignment:
| Q |
10 |
ttaaatatgtgagatagcgtcattatagtctttgaatgaatcgaaacttaaacattcctaagtgtgttttctggacc |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4823999 |
ttaaatatgtgagatagcgtcattatagtctttgaatgaatcgaaacttaaacattcctaagtgtgttttctggacc |
4824075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 87 - 140
Target Start/End: Original strand, 4824363 - 4824416
Alignment:
| Q |
87 |
ttcctgtcagttacttatagaagtgagtaaacactccaaaattggtacattgaa |
140 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4824363 |
ttcctgtcagtttcttatagaagtgagtaaacactccaaaattggtacattgaa |
4824416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University