View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145-Insertion-13 (Length: 136)
Name: NF5145-Insertion-13
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145-Insertion-13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 136
Target Start/End: Complemental strand, 47290951 - 47290823
Alignment:
| Q |
8 |
ctcaggtatttttcgagttttgaaaccgcaagatccaagagaggaatttccttataggaaacagattggcaagcttctttatttaactccttctcgtcgt |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47290951 |
ctcagttatttttcgagttttgaaaccgcaagatccaagagaggaatttccttacaggaagctgattggcaagcttctttatttaactccttctcgtcgt |
47290852 |
T |
 |
| Q |
108 |
gacatttctttttcagtttgtaggcttag |
136 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47290851 |
gacatttctttttcagtttgtaggcttag |
47290823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University