View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145-Insertion-14 (Length: 117)
Name: NF5145-Insertion-14
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145-Insertion-14 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 12 - 117
Target Start/End: Original strand, 6357509 - 6357614
Alignment:
| Q |
12 |
aaggtgttagaaaaatccgagagtgattcatattaacaacacttgaatctttgtatgtaaagtattgaaaaaactcatactgtcataaaaatcaaactga |
111 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6357509 |
aaggtgtaagaaaaatccgagagtgattcatattaacaacacttgaatctttgtatgtaaaatattgaaaaaactcatactatcataaaaatcaaactga |
6357608 |
T |
|
| Q |
112 |
aaatgt |
117 |
Q |
| |
|
|||||| |
|
|
| T |
6357609 |
aaatgt |
6357614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University