View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145-Insertion-8 (Length: 262)
Name: NF5145-Insertion-8
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145-Insertion-8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 15 - 111
Target Start/End: Complemental strand, 3854996 - 3854900
Alignment:
| Q |
15 |
tcgttgggattggttgaagaagttcatccgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatattaacaacaac |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3854996 |
tcgttgggattggttgaagaagttcatccgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatattagcaacaac |
3854900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 190 - 262
Target Start/End: Complemental strand, 3854833 - 3854761
Alignment:
| Q |
190 |
ggaggaggaggctatggattaagcgttgatgatcataattcattgcatccacaatttgttcccaactgcaatg |
262 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3854833 |
ggaggaggaggctatggatcaagcgttgatgatcataattcattgcatccacaatttgtccccaactgcaatg |
3854761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 11 - 103
Target Start/End: Original strand, 4141638 - 4141730
Alignment:
| Q |
11 |
attatcgttgggattggttgaagaagttcatccgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatatta |
103 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
4141638 |
attatcattgggattggttgaagaaattcatccgcgcctgcccctctcttcaaagtattgtgattcataaggtttgttaactctatcatatta |
4141730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 185 - 262
Target Start/End: Original strand, 4141819 - 4141896
Alignment:
| Q |
185 |
tcggaggaggaggaggctatggattaagcgttgatgatcataattcattgcatccacaatttgttcccaactgcaatg |
262 |
Q |
| |
|
|||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4141819 |
tcggaggaggagtaggttatggattaagcggcgatgatcataattcattgcatccacaatttgtccccaactgcaatg |
4141896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University