View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145_high_20 (Length: 250)
Name: NF5145_high_20
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145_high_20 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 17429444 - 17429676
Alignment:
| Q |
18 |
ataactgctttaagggatgcggatagagtgacgggattgttggagtgtgatgggattagggatattaagatgatagtgaatagggttaggacggatatga |
117 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17429444 |
ataactgcgttgagggatgcggatagagtgacgggattgttggagtgtgatgggattagggatattaagatgatagtgaatagggttaggacggatatga |
17429543 |
T |
 |
| Q |
118 |
ttaaaggcgaagatatgatgtcggttttggatgtgcaagagatgttgggtttgccgttgcttggtgttataccggaggatagcgaggttataaggagtac |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
17429544 |
ttaaaggtgaagatatgatgtcggttttggatgtgcaagagatgttgggtttgccgttgcttggtgttataccagaggatagtgaggttataaggagtac |
17429643 |
T |
 |
| Q |
218 |
gaatagagggtatccgcttgttttgaataagcc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17429644 |
aaatagagggtatccgcttgttttgaataagcc |
17429676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University