View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145_high_23 (Length: 240)
Name: NF5145_high_23
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145_high_23 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 23 - 240
Target Start/End: Complemental strand, 4823997 - 4823780
Alignment:
| Q |
23 |
gaccagatgactatttactcacagtttggagtagtatgagcaactgaaggaagtagtaagaggctcctccaattgtagcatacttcaacttctcttttcc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4823997 |
gaccagatgactatttactcacagtttggagtagtatgagcaactgaaggaagtagtaagaggctcctccaattgtagcatacttcaacttctcttttcc |
4823898 |
T |
 |
| Q |
123 |
ttcaacgtctgagaaatcatcgtcttttgaacgactaaagcctccaactaaccatccaagatttctgtagcctccattatacagctttgaagttgctgtc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4823897 |
ttcaacgtctgagaaatcatcgtcttttgaacgactaaagcctccaactaaccatccaagatttctgtaacctccattatacagctttgaagttgctgtc |
4823798 |
T |
 |
| Q |
223 |
attgacctgaatagtcac |
240 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4823797 |
attgacctgaatagtcac |
4823780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University