View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145_high_27 (Length: 226)
Name: NF5145_high_27
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145_high_27 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 4268706 - 4268486
Alignment:
| Q |
7 |
cataggcacctaaaaaccatcgaaaggtagttagttgtcgtttgaacactttttaaataggttcaaatggtttaaaaagtacctaaccggtaattaattg |
106 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4268706 |
cataggcacctaaaaaccatcgaaatgtagttagttgttgtttgaacactttttaaatcggttcaaatggtttaaaaagtacctaaccggtaattaattg |
4268607 |
T |
 |
| Q |
107 |
tggtttggtcttttttagggtgcctaaagagcaagtgccttcttctggtttggatggcccaagctgcttctacatctcatgaacttcgtactgtactact |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4268606 |
tggtttggtcttttttagggtgcctaaagagcaagtgccttcttctggtttggatggcccaagctgcttctacatctcatgaacttcgtactgtactacc |
4268507 |
T |
 |
| Q |
207 |
ga-ctgtttcatcttatttat |
226 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
4268506 |
gacctgtttcatcttatttat |
4268486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University