View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145_low_24 (Length: 250)
Name: NF5145_low_24
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145_low_24 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 7669524 - 7669286
Alignment:
| Q |
13 |
aatatgtacatcaatgttaagttcaacgtgtttcgctttttcctcttcnnnnnnntagtatgttttgtacttttatgacgattacgctttttgcgtatgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
7669524 |
aatatgtacatcaatgttaagttcaacgtgtttcgctttttcctcttcaaaaaaacagtatgttttgtacttttatgacgattacgttttttgggtatgt |
7669425 |
T |
 |
| Q |
113 |
aatgatgaactttttgttgaatatttatccccgcttttgtccatacttgaatttg-aaaaactcatctttatatttacgtgttcaaatcatcttcattta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7669424 |
aatgatgaactttttgttgaatatttatcctcgcttttgtccatacttgaattcgaaaaaactcatctttatatttacgtgttcaaatcatcttcattta |
7669325 |
T |
 |
| Q |
212 |
ttgttgattacttcgagttgaagagatagacaaaatgaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7669324 |
ttgttgattacttcgagttgaagagatagacaaaatgaa |
7669286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University