View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145_low_26 (Length: 248)
Name: NF5145_low_26
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 24 - 192
Target Start/End: Original strand, 2844092 - 2844263
Alignment:
| Q |
24 |
tttcctatgtttggctggatcttagcagaagccaaagtcggtttcctaatattaaggtttgtttcagaatctcaagctgacacacttca---ctctatca |
120 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2844092 |
tttcatatgtttggctggatcttagcagaagccaaagtcggtttcctaaaattaaggtttgtttcagaatctcaagctgacacacttcatcactctatca |
2844191 |
T |
|
| Q |
121 |
ttctcacacatatataccacccatcttttcactctttcttcatatccatcaaattctcttgttttctttttt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2844192 |
ttctcacacatatataccacccatcttttcactctttcttcatatccatcaaattctcttgttttctttttt |
2844263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University