View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145_low_29 (Length: 236)
Name: NF5145_low_29
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 218
Target Start/End: Original strand, 35449072 - 35449278
Alignment:
| Q |
12 |
atgagcagacatatcaaccatacgaaatggtgatccagtaccgttattaaagattggcgtagctgatgtattgccgacaattgggcaggcctccaggaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35449072 |
atgagcagacatatcaaccatacgaaatggtgatccagtaccgttattaaagattggcgtagctgatgtattgccgacaattgggcaggcctccaggaca |
35449171 |
T |
 |
| Q |
112 |
ttttcatcagtaccaaacatgcgagtagaagaacttggatattcaggttctgatatggctgttccctcattaattccttgttgaaagcccatgttcgtgt |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35449172 |
ttttcatcaataccaaacatgcgagtagaagaacttggatattcaggttctgatatggctattccctcattaattccttgttgaaagcccatgttcgtgt |
35449271 |
T |
 |
| Q |
212 |
tctgact |
218 |
Q |
| |
|
||||||| |
|
|
| T |
35449272 |
tctgact |
35449278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 13 - 218
Target Start/End: Original strand, 35448845 - 35449047
Alignment:
| Q |
13 |
tgagcagacatatcaaccatacgaaatggtgatccagtaccgttattaaagattggcgtagctgatgtattgccgacaattgggcaggcctccaggacat |
112 |
Q |
| |
|
||||||||||| ||||||||| |||||| ||||||| || ||| || |||||||| ||||||||| ||| | |||||||||||||| ||||| ||||| |
|
|
| T |
35448845 |
tgagcagacatctcaaccatatgaaatgatgatcca---ccattactatagattggcatagctgatgcattcctgacaattgggcaggtctccatgacat |
35448941 |
T |
 |
| Q |
113 |
tttcatcagtaccaaacatgcgagtagaagaacttggatattcaggttctgatatggctgttccctcattaattccttgttgaaagcccatgttcgtgtt |
212 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||||||||||||||||||| |||||| | ||| ||||||||||||||||||| |||||||||| ||| |
|
|
| T |
35448942 |
tttcatcaacaccaaacatgctaggagaagaacttggatattcaggttctgttatggccatccccccattaattccttgttgaaaacccatgttcgagtt |
35449041 |
T |
 |
| Q |
213 |
ctgact |
218 |
Q |
| |
|
|||||| |
|
|
| T |
35449042 |
ctgact |
35449047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University