View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5145_low_30 (Length: 230)

Name: NF5145_low_30
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5145_low_30
NF5145_low_30
[»] chr5 (2 HSPs)
chr5 (5-73)||(7669036-7669104)
chr5 (142-172)||(7668936-7668966)


Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 7669104 - 7669036
Alignment:
5 tcattttaaaattattgttaaatttttatagtgcaagagttttgtgatttgtcattcatttattgcgct 73  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
7669104 tcattttaaaattattgttaaatttttttagtgcaagagttttgtgatttgtcattcatttattgcgct 7669036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 172
Target Start/End: Complemental strand, 7668966 - 7668936
Alignment:
142 tgatgcagactgactgactgattctttgatt 172  Q
    |||||||||||||||||||||||||||||||    
7668966 tgatgcagactgactgactgattctttgatt 7668936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University