View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145_low_30 (Length: 230)
Name: NF5145_low_30
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 7669104 - 7669036
Alignment:
| Q |
5 |
tcattttaaaattattgttaaatttttatagtgcaagagttttgtgatttgtcattcatttattgcgct |
73 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7669104 |
tcattttaaaattattgttaaatttttttagtgcaagagttttgtgatttgtcattcatttattgcgct |
7669036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 172
Target Start/End: Complemental strand, 7668966 - 7668936
Alignment:
| Q |
142 |
tgatgcagactgactgactgattctttgatt |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7668966 |
tgatgcagactgactgactgattctttgatt |
7668936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University