View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5145_low_33 (Length: 212)
Name: NF5145_low_33
Description: NF5145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5145_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 201
Target Start/End: Original strand, 35786502 - 35786688
Alignment:
| Q |
15 |
atattcatctgctgttgttgctgattcaaaacatgttgtgcatgttgttgattcaaaacattttgtgcatgttgttcttgatcatgatgatgactactat |
114 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786502 |
atattcatctgctgctgttgctgattcaaaacatgttgtgcatgttgttgattcaaaacattttgtgcatgttgttcttgatcatgatgatgactactat |
35786601 |
T |
 |
| Q |
115 |
gaatattctgaccgtacgaggtaattgatttaacagaatcaccacttgcatgttcaaaatcttgatttagttgttgatgatgatatt |
201 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786602 |
gaatattctgaccgtacgaagtaattgatttaacagaatcaccacttgcatgttcaaaatcttgatttagttgttgatgatgatatt |
35786688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University