View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5146_high_1 (Length: 455)
Name: NF5146_high_1
Description: NF5146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5146_high_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 262; Significance: 1e-146; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 36 - 317
Target Start/End: Original strand, 23332595 - 23332876
Alignment:
| Q |
36 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
135 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
|
| Q |
136 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacataagtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332695 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggctgtacatacgtcagggtgacccacgcaccacgatctaccttatagaaacccttc |
23332794 |
T |
|
| Q |
236 |
agctcagcccaaccatcccgcagatagaccttgccatttttcacgtggaccttgacctcgaacatgtttctgtttggatcac |
317 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23332795 |
agctcagcccaaccatcccgcagataaaccttgccatttttcacgtggaccttgaccttgaacatgtttctgtttggatcac |
23332876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 23322333 - 23322373
Alignment:
| Q |
1 |
catcatcaaacacaatcgttgtaaaatccaaacgcatatgt |
41 |
Q |
| |
|
||||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23322333 |
catcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23322373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 23332500 - 23332540
Alignment:
| Q |
1 |
catcatcaaacacaatcgttgtaaaatccaaacgcatatgt |
41 |
Q |
| |
|
||||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23332500 |
catcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23332540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 375 - 444
Target Start/End: Complemental strand, 43075244 - 43075175
Alignment:
| Q |
375 |
tcagtggtccattccttcttccctttcacaccattttcactttcattctcttctgtacctctctgcttct |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43075244 |
tcagtggtccattccttcttccctttcacaccattttcactttcattctcttctgtacctctctgcttct |
43075175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University