View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5146_high_12 (Length: 336)
Name: NF5146_high_12
Description: NF5146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5146_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 8e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 133 - 327
Target Start/End: Original strand, 6323184 - 6323375
Alignment:
| Q |
133 |
ttcacaaaattcaattctttttgtggagtgaattcagttcgatcatcactgttttcctcgcttgtgttcgtggcggcgatttgtctcagtgttcctgtga |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6323184 |
ttcacaaaattcaattctttttgtggagtgaattcagttcgatcatcactgttttcctcgcttgtgtttgtggcggcgatttgtctcagtgttcctgtga |
6323283 |
T |
 |
| Q |
233 |
tgatacaaacacagtgtcatcttaatttcaaatcatcaatctttgtttttgatcccgaaggaatattcacttggtcttccttcgttgcaacacca |
327 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
6323284 |
tgatgcaaacacagtgtcatcttaatttcaaatcatcaatctttgtttttgatcccaaag---cattcacttggtcttccttcgtcgcaacacca |
6323375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University