View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5146_high_4 (Length: 378)
Name: NF5146_high_4
Description: NF5146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5146_high_4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 30 - 259
Target Start/End: Complemental strand, 34899975 - 34899746
Alignment:
| Q |
30 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899975 |
atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttcttctctcgctatttgatgtcaacaaaagctaa |
34899876 |
T |
|
| Q |
130 |
attgtgtcttcccctgcgtgtatgcaaccttatagtctcaaaattttccttccattcccaccaaacatgaaaggtatgtatcttccaactacaaaatttt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899875 |
attgtgtcttcccctgcgtgtatgcaaccttatagtctcaaaattttccttccattctcaccaaacatgaaaggtatgtatcttccaactacaaaatttt |
34899776 |
T |
|
| Q |
230 |
atgtgaatttgtgcagatgatatcactgac |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34899775 |
atgtgaatttgtgcagatgatatcactgac |
34899746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 69; Significance: 7e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 310 - 378
Target Start/End: Complemental strand, 8450858 - 8450790
Alignment:
| Q |
310 |
cagtcagtgatttgtgagtattaagtaacatgtaatctatttggtattgttttgaatcaatacatgttg |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8450858 |
cagtcagtgatttgtgagtattaagtaacatgtaatctatttggtattgttttgaatcaatacatgttg |
8450790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University