View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5146_high_6 (Length: 351)
Name: NF5146_high_6
Description: NF5146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5146_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 115 - 341
Target Start/End: Original strand, 16797443 - 16797669
Alignment:
| Q |
115 |
tttggagtccacttgagggataatccctctccgatgcaaactgaatttcatcggcagcctatccaaaagtagttgccacgacaaggtggacactttcata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16797443 |
tttggagtccacttgagggataatccctctccgatgcaaattgaatttcatcggcagcctatccaaaagtagttgccatgacaaggtggacactttcata |
16797542 |
T |
|
| Q |
215 |
ggcgcccaactcttccacaaattacgataaacatagagtttcaatggagatttactaagatgaggctggcaaagactcctaagaagtagatatgtggatt |
314 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16797543 |
ggagcccaactcttccacaaattacgataaacatagagtttcaatggagatttactaagatgaggctggcaaagactcctaagaagtagatatgtggatt |
16797642 |
T |
|
| Q |
315 |
taaccgtaaaacaccccccattctctg |
341 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
16797643 |
taaccgtaaaacaccccccattctctg |
16797669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 16797323 - 16797408
Alignment:
| Q |
1 |
aacaagccaatggaacacttcataccaaacagcggatacaaaattacaatgcaggaaaagatgtaaagcctgtttagacgagttcc |
86 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16797323 |
aacaagccaatgggacacttcataccaaacagcggatacaaaattacaatgcaggaaaagatgtaaagcctgtttagacgagttcc |
16797408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University