View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5146_low_1 (Length: 251)
Name: NF5146_low_1
Description: NF5146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5146_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 21 - 244
Target Start/End: Original strand, 39076220 - 39076443
Alignment:
| Q |
21 |
gcatttatgaaaaagtaaaacaagtgcaggttgaacaaaaagctttttcgattgcacgaacaaatatgaatttgtcttaacaagctaaatgcatggacat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076220 |
gcatttatgaaaaagtaaaacaagtgcaggttgaacaaaaagctttttcgattgcacgaacaaatatgaatttgtcttaacaagctaaatgcatggacat |
39076319 |
T |
 |
| Q |
121 |
taattgcttaactatataagtcttcattcagtgttttcttcgcataattgttgagctgcatatacttagtcaattaaatacaaattagtgcaagtaaatg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39076320 |
taattgcttaactatataagtcttcattcagtgttttcttcgcataattgttgagctgcatatacttagtcaattaaaaacaaattagtgcaagtaaatg |
39076419 |
T |
 |
| Q |
221 |
tttagacaatgcaatgatgatgtc |
244 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39076420 |
tttagacaatgcaatgatgatgtc |
39076443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University