View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5147-Insertion-5 (Length: 54)
Name: NF5147-Insertion-5
Description: NF5147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5147-Insertion-5 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 43; Significance: 2e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 2e-16
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 3874153 - 3874199
Alignment:
| Q |
8 |
aaagtaacactaattggttgttcatcatcttccaattcactctctga |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3874153 |
aaagtaacactaattggttgttcatcatcttccaactcactctctga |
3874199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 2e-16
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 3884681 - 3884727
Alignment:
| Q |
8 |
aaagtaacactaattggttgttcatcatcttccaattcactctctga |
54 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3884681 |
aaagtaacactaataggttgttcatcatcttccaattcactctctga |
3884727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University