View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5147_high_10 (Length: 246)
Name: NF5147_high_10
Description: NF5147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5147_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 44 - 228
Target Start/End: Original strand, 29423178 - 29423361
Alignment:
| Q |
44 |
cagaaagtactttatgaccatacccaagacaatacctctccccctcctctctctcttcataatttatccatgttactgttttgtgtagtagaaaaaatat |
143 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29423178 |
cagaaagtactttatgaccatacccaagataatacctctcaccctcctctctctcttcataatttatccatgttactgtttagtgtagtagaaaaaatat |
29423277 |
T |
 |
| Q |
144 |
ttttcttagaaatttattgattaattaggcaatatttgtactactaaccgaaactttataccccatacgtacttaattcttctca |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||||| ||||||||||| |
|
|
| T |
29423278 |
ttttcttagaaatttattgattaattaggcaatatttgtactatgaaccaaaactttata-cccatacgtactgaattcttctca |
29423361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 187
Target Start/End: Complemental strand, 13574285 - 13574225
Alignment:
| Q |
127 |
tgtagtagaaaaaatatttttcttagaaatttattgattaattaggcaatatttgtactac |
187 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||| ||||||| || ||||| ||||||| |
|
|
| T |
13574285 |
tgtagtagaaaaaatgtttttcttaaaaatttattaattaatttggtaatataagtactac |
13574225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University