View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5147_high_11 (Length: 240)
Name: NF5147_high_11
Description: NF5147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5147_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 16797551 - 16797443
Alignment:
| Q |
1 |
ttgggcgcctatgaaagtgtccaccttgtcgtggcaactacttttggataggctgccgatgaaattcaatttgcatcggagagggattatccctcaagtg |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16797551 |
ttgggctcctatgaaagtgtccaccttgtcatggcaactacttttggataggctgccgatgaaattcaatttgcatcggagagggattatccctcaagtg |
16797452 |
T |
|
| Q |
101 |
gactccaaa |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
16797451 |
gactccaaa |
16797443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 138 - 223
Target Start/End: Complemental strand, 16797408 - 16797323
Alignment:
| Q |
138 |
ggaactcgtctaaacaggctttacatcttttcctgcattgtaattttgtatccgctgtttggtatgaagtgttccattggcttgtt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16797408 |
ggaactcgtctaaacaggctttacatcttttcctgcattgtaattttgtatccgctgtttggtatgaagtgtcccattggcttgtt |
16797323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University